De-Novo Letermovir Resistant Mutations in Cytomegalovirus-Infected Tissues of Solid Organs Transplant Recipients
S. HAN, H. Cho, S. Min, Y. Hong
Internal Medicine, Yonsei University Health System, Yonsei University College of Medicine, Seoul, Korea, Republic of
Meeting: 2019 American Transplant Congress
Abstract number: A324
Keywords: Cytomeglovirus, Ganciclovir, Screening, Viral therapy
Session Information
Session Name: Poster Session A: Transplant Infectious Diseases
Session Type: Poster Session
Date: Saturday, June 1, 2019
Session Time: 5:30pm-7:30pm
Presentation Time: 5:30pm-7:30pm
Location: Hall C & D
*Purpose: Letermovir, cytomegalovirus (CMV) DNA-terminase complex (UL51, UL56, and UL89) inhibitor, revealed the efficient prophylactic effect against CMV infection including disease and DNAemia with low-grade adverse events in allogeneic hematopoietic stem cell transplant recipients. The potent in-vitro anti-CMV activity and improved safety of letermovir will promise to be diversely used as preventive strategies of prophylaxis and pre-emptive therapy or treatment of CMV end-organ tissue-invasive diseases in solid organ transplant (SOT) recipients, instead of ganciclovir and valganciclovir with several toxicities including bone marrow suppression. The clustered mutations at mainly codon 231-369 region in UL56 can associate with phenotypic resistance against letermovir. In spite of several reports for intrinsic resistance against antiretroviral drugs, particularly integrase inhibitors, in chronic HIV-infected individuals, little is known the frequency of de-novo genotypic resistant mutations at CMV-infected organ tissues in SOT recipients.
*Methods: We collected a total of 31 formalin-fixed paraffin-embedded (FFPE) tissues showing positive CMV immunochemical staining from SOT recipients (23 of kidney, 6 of liver, and 2 of heart transplantation) between Jan. 2007 and Aug. 2016. The 723-1107 nucleotide of CMV UL56 with 50 ng of genomic viral DNA extracted from FFPE tissues were amplified by polymerase chain reaction (PCR) with four different primers targeting (1) valine of 236 amino acid (AA) (F-5’AGCTGACCATCATCCCGAAT3’ and R-5’TGGATGTAGCTGTGGTAGGC3’), (2) leucine of 241 AA (F-5’AAGATCTACCCGGAGGTGGT3’ and R-5’CTCGATGTCGTTGAGTGTGG3’) (3) cysteine of 325 AA (F-5’GCCTACCACAGCTACATCCA3’ and R-5’GAGCACGAAGATGTCCTCCA3’), (4) arginine of 369 AA (F-5’GTGGAGGACATCTTCGTGCT3’ and R-5’CCGTCATCAAAGTCGTACCC3’). All of single nucleotide polymorphism (SNP) for 723-1107 nucleotides in CMV UL56 were examined by Sanger sequencing of PCR product.
*Results: We did not find any SNPs leading to 21 AA codon changes known as association with in vitro phenotypic resistance by significant increased half maximal effective concentration (EC50) against letermovir including V231A/L, N232Y, V236L, E237D, L241P, T244K/R, L257I, K258E, F261L/C, Y321C, C325F/R/W, M329T, R369M/G/S, and L373I In addition, there was no resistance mutations causing V236M, C325Y, and E237G substitution, which were identified in patients with prophylaxis failure in clinical trials. However, we identified three SNPs with substantial frequency of H268R (CGC substituted for CAC; 9 of 31, 29.0%), I344F (TTC substituted for ATC; 20 of 31, 64.5%), I440F (TTC substituted for ATC; 5 of 31, 16.1%), and M434I (ATT substituted for ATG; 1 of 31, 3.2%).
*Conclusions: The AA changes causing the known phenotypic letermovir resistance were not detected in CMV-infected tissues of SOT recipients. This data can support letermorvir could treat CMV-infected organs without intrinsic resistance issue in SOT recipients. However, it would be necessary for in vitro EC50 experiment against letermovir for clinical isolates with new SNPs in UL56.
To cite this abstract in AMA style:
HAN S, Cho H, Min S, Hong Y. De-Novo Letermovir Resistant Mutations in Cytomegalovirus-Infected Tissues of Solid Organs Transplant Recipients [abstract]. Am J Transplant. 2019; 19 (suppl 3). https://atcmeetingabstracts.com/abstract/de-novo-letermovir-resistant-mutations-in-cytomegalovirus-infected-tissues-of-solid-organs-transplant-recipients/. Accessed August 13, 2026.« Back to 2019 American Transplant Congress
