ATC Abstracts

American Transplant Congress abstracts

  • Home
  • Meetings Archive
    • 2022 American Transplant Congress
    • 2021 American Transplant Congress
    • 2020 American Transplant Congress
    • 2019 American Transplant Congress
    • 2018 American Transplant Congress
    • 2017 American Transplant Congress
    • 2016 American Transplant Congress
    • 2015 American Transplant Congress
    • 2013 American Transplant Congress
  • Keyword Index
  • Resources
    • 2021 Resources
    • 2016 Resources
      • 2016 Welcome Letter
      • ATC 2016 Program Planning Committees
      • ASTS Council 2015-2016
      • AST Board of Directors 2015-2016
    • 2015 Resources
      • 2015 Welcome Letter
      • ATC 2015 Program Planning Committees
      • ASTS Council 2014-2015
      • AST Board of Directors 2014-2015
      • 2015 Conference Schedule
  • Search

De-Novo Letermovir Resistant Mutations in Cytomegalovirus-Infected Tissues of Solid Organs Transplant Recipients

S. HAN, H. Cho, S. Min, Y. Hong

Internal Medicine, Yonsei University Health System, Yonsei University College of Medicine, Seoul, Korea, Republic of

Meeting: 2019 American Transplant Congress

Abstract number: A324

Keywords: Cytomeglovirus, Ganciclovir, Screening, Viral therapy

Session Information

Session Name: Poster Session A: Transplant Infectious Diseases

Session Type: Poster Session

Date: Saturday, June 1, 2019

Session Time: 5:30pm-7:30pm

 Presentation Time: 5:30pm-7:30pm

Location: Hall C & D

*Purpose: Letermovir, cytomegalovirus (CMV) DNA-terminase complex (UL51, UL56, and UL89) inhibitor, revealed the efficient prophylactic effect against CMV infection including disease and DNAemia with low-grade adverse events in allogeneic hematopoietic stem cell transplant recipients. The potent in-vitro anti-CMV activity and improved safety of letermovir will promise to be diversely used as preventive strategies of prophylaxis and pre-emptive therapy or treatment of CMV end-organ tissue-invasive diseases in solid organ transplant (SOT) recipients, instead of ganciclovir and valganciclovir with several toxicities including bone marrow suppression. The clustered mutations at mainly codon 231-369 region in UL56 can associate with phenotypic resistance against letermovir. In spite of several reports for intrinsic resistance against antiretroviral drugs, particularly integrase inhibitors, in chronic HIV-infected individuals, little is known the frequency of de-novo genotypic resistant mutations at CMV-infected organ tissues in SOT recipients.

*Methods: We collected a total of 31 formalin-fixed paraffin-embedded (FFPE) tissues showing positive CMV immunochemical staining from SOT recipients (23 of kidney, 6 of liver, and 2 of heart transplantation) between Jan. 2007 and Aug. 2016. The 723-1107 nucleotide of CMV UL56 with 50 ng of genomic viral DNA extracted from FFPE tissues were amplified by polymerase chain reaction (PCR) with four different primers targeting (1) valine of 236 amino acid (AA) (F-5’AGCTGACCATCATCCCGAAT3’ and R-5’TGGATGTAGCTGTGGTAGGC3’), (2) leucine of 241 AA (F-5’AAGATCTACCCGGAGGTGGT3’ and R-5’CTCGATGTCGTTGAGTGTGG3’) (3) cysteine of 325 AA (F-5’GCCTACCACAGCTACATCCA3’ and R-5’GAGCACGAAGATGTCCTCCA3’), (4) arginine of 369 AA (F-5’GTGGAGGACATCTTCGTGCT3’ and R-5’CCGTCATCAAAGTCGTACCC3’). All of single nucleotide polymorphism (SNP) for 723-1107 nucleotides in CMV UL56 were examined by Sanger sequencing of PCR product.

*Results: We did not find any SNPs leading to 21 AA codon changes known as association with in vitro phenotypic resistance by significant increased half maximal effective concentration (EC50) against letermovir including V231A/L, N232Y, V236L, E237D, L241P, T244K/R, L257I, K258E, F261L/C, Y321C, C325F/R/W, M329T, R369M/G/S, and L373I In addition, there was no resistance mutations causing V236M, C325Y, and E237G substitution, which were identified in patients with prophylaxis failure in clinical trials. However, we identified three SNPs with substantial frequency of H268R (CGC substituted for CAC; 9 of 31, 29.0%), I344F (TTC substituted for ATC; 20 of 31, 64.5%), I440F (TTC substituted for ATC; 5 of 31, 16.1%), and M434I (ATT substituted for ATG; 1 of 31, 3.2%).

*Conclusions: The AA changes causing the known phenotypic letermovir resistance were not detected in CMV-infected tissues of SOT recipients. This data can support letermorvir could treat CMV-infected organs without intrinsic resistance issue in SOT recipients. However, it would be necessary for in vitro EC50 experiment against letermovir for clinical isolates with new SNPs in UL56.

  • Tweet
  • Email a link to a friend (Opens in new window) Email
  • Print (Opens in new window) Print

To cite this abstract in AMA style:

HAN S, Cho H, Min S, Hong Y. De-Novo Letermovir Resistant Mutations in Cytomegalovirus-Infected Tissues of Solid Organs Transplant Recipients [abstract]. Am J Transplant. 2019; 19 (suppl 3). https://atcmeetingabstracts.com/abstract/de-novo-letermovir-resistant-mutations-in-cytomegalovirus-infected-tissues-of-solid-organs-transplant-recipients/. Accessed April 11, 2026.

« Back to 2019 American Transplant Congress

Visit Our Partner Sites

American Transplant Congress (ATC)

Visit the official site for the American Transplant Congress »

American Journal of Transplantation

The official publication for the American Society of Transplantation (AST) and the American Society of Transplant Surgeons (ASTS) »

American Society of Transplantation (AST)

An organization of more than 3000 professionals dedicated to advancing the field of transplantation. »

American Society of Transplant Surgeons (ASTS)

The society represents approximately 1,800 professionals dedicated to excellence in transplantation surgery. »

Copyright © 2013-2026 by American Society of Transplantation and the American Society of Transplant Surgeons. All rights reserved.

Privacy Policy | Terms of Use | Cookie Preferences