ATC Abstracts

American Transplant Congress abstracts

  • Home
  • Meetings Archive
    • 2022 American Transplant Congress
    • 2021 American Transplant Congress
    • 2020 American Transplant Congress
    • 2019 American Transplant Congress
    • 2018 American Transplant Congress
    • 2017 American Transplant Congress
    • 2016 American Transplant Congress
    • 2015 American Transplant Congress
    • 2013 American Transplant Congress
  • Keyword Index
  • Resources
    • 2021 Resources
    • 2016 Resources
      • 2016 Welcome Letter
      • ATC 2016 Program Planning Committees
      • ASTS Council 2015-2016
      • AST Board of Directors 2015-2016
    • 2015 Resources
      • 2015 Welcome Letter
      • ATC 2015 Program Planning Committees
      • ASTS Council 2014-2015
      • AST Board of Directors 2014-2015
      • 2015 Conference Schedule
  • Search

Establishment of SCID Pigs Cell Lines to Prevent Immunodeficiency Using RGEN System.

D.-H. Kim,1 J.-S. Ahn,1 S. Hwang,2 J.-W. Lee.1

1Functional Genomics Reaserch Center, KRIBB, Daejeon, Korea
2Animal Biotechnology Division, RDA, Wanju-gun, Jeollabuk-do, Korea.

Meeting: 2016 American Transplant Congress

Abstract number: D85

Keywords: Hyperacute rejection, Xenotransplantation

Session Information

Session Name: Poster Session D: Chimerism/Stem Cells, Cellular/Islet Transplantation, Innate Immunity, Chronic Rejection

Session Type: Poster Session

Date: Tuesday, June 14, 2016

Session Time: 6:00pm-7:00pm

 Presentation Time: 6:00pm-7:00pm

Location: Halls C&D

Severe immune disorder is the biggest problem in xenotransplantation. To overcome the the problem, producing severe combined immune deficiency (SCID) pigs which lack T cell is needed. Previous studies shows that IL2RG gene is associated T cell and NK cell development and RAG2 mainly functions in T cell development. In this study, to produce SCID pigs, we established IL2RG and RAG2 knockout pig cell lines using RGEN system. We designed specific sgRNAs which target porcine IL2RG and RAG2 and constructed RGEN systems

Targeting Gene

Targeting sequence (PAM)

IL2RG

AAGCTTCTCTCTGCCTAGTG (TGG)

AGCTCTACACATTCCGTGTT (CGG)

AGCCGCTATAACCCGCTCTG (TGG)

GCGCTCAGCGTTGGAGCGAC (TGG)

RAG2

TGCAGAGAGAAAGACTTGGT (AGG)

ATTGATGTCGTGTATAGTCG (AGG)

AGTATGGGTGTTCTCTTTGG (AGG)

. The region of DNA containing the target site was amplified by PCR. The PCR products were hybridized to form heteroduplex DNA, and digested by T7 endonuclease I. The DNA was analyzed by gel electrophoresis . Cas9-IL2RG and Cas9-RAG2 vectors were transfected both or respectively into porcine fibroblast using lipofectamine. Also, to select transfected cells, GFP positive cells were isolated and each of the cells was cultured individually. To verify genetic information, IL2RG and RAG2 genes from the cells were amplified and analyzed the sequences. To confirm the knockout of the genes, we analyzed the DNA sequences. As a result, we established 3 cell lines in IL2RG: 5d, 1a, 190a, and 3 cell lines in RAG2: 2d, 19d, and 1a. Also, for double knockout, we co-transfected the two vectors into the PEF cells, and sorted cells were analyzed. 1d cell line was isolated . As a result, we successfully established cell lines to produce SCID pigs and are trying to produce IL2RG and/or RAG2 knock out pigs.

CITATION INFORMATION: Kim D.-H, Ahn J.-S, Hwang S, Lee J.-W. Establishment of SCID Pigs Cell Lines to Prevent Immunodeficiency Using RGEN System. Am J Transplant. 2016;16 (suppl 3).

  • Tweet
  • Email a link to a friend (Opens in new window) Email
  • Print (Opens in new window) Print

To cite this abstract in AMA style:

Kim D-H, Ahn J-S, Hwang S, Lee J-W. Establishment of SCID Pigs Cell Lines to Prevent Immunodeficiency Using RGEN System. [abstract]. Am J Transplant. 2016; 16 (suppl 3). https://atcmeetingabstracts.com/abstract/establishment-of-scid-pigs-cell-lines-to-prevent-immunodeficiency-using-rgen-system/. Accessed May 1, 2026.

« Back to 2016 American Transplant Congress

Visit Our Partner Sites

American Transplant Congress (ATC)

Visit the official site for the American Transplant Congress »

American Journal of Transplantation

The official publication for the American Society of Transplantation (AST) and the American Society of Transplant Surgeons (ASTS) »

American Society of Transplantation (AST)

An organization of more than 3000 professionals dedicated to advancing the field of transplantation. »

American Society of Transplant Surgeons (ASTS)

The society represents approximately 1,800 professionals dedicated to excellence in transplantation surgery. »

Copyright © 2013-2026 by American Society of Transplantation and the American Society of Transplant Surgeons. All rights reserved.

Privacy Policy | Terms of Use | Cookie Preferences