Establishment of SCID Pigs Cell Lines to Prevent Immunodeficiency Using RGEN System.
1Functional Genomics Reaserch Center, KRIBB, Daejeon, Korea
2Animal Biotechnology Division, RDA, Wanju-gun, Jeollabuk-do, Korea.
Meeting: 2016 American Transplant Congress
Abstract number: D85
Keywords: Hyperacute rejection, Xenotransplantation
Session Information
Session Name: Poster Session D: Chimerism/Stem Cells, Cellular/Islet Transplantation, Innate Immunity, Chronic Rejection
Session Type: Poster Session
Date: Tuesday, June 14, 2016
Session Time: 6:00pm-7:00pm
Presentation Time: 6:00pm-7:00pm
Location: Halls C&D
Severe immune disorder is the biggest problem in xenotransplantation. To overcome the the problem, producing severe combined immune deficiency (SCID) pigs which lack T cell is needed. Previous studies shows that IL2RG gene is associated T cell and NK cell development and RAG2 mainly functions in T cell development. In this study, to produce SCID pigs, we established IL2RG and RAG2 knockout pig cell lines using RGEN system. We designed specific sgRNAs which target porcine IL2RG and RAG2 and constructed RGEN systems
Targeting Gene |
Targeting sequence (PAM) |
IL2RG |
AAGCTTCTCTCTGCCTAGTG (TGG) |
AGCTCTACACATTCCGTGTT (CGG) |
|
AGCCGCTATAACCCGCTCTG (TGG) |
|
GCGCTCAGCGTTGGAGCGAC (TGG) |
|
RAG2 |
TGCAGAGAGAAAGACTTGGT (AGG) |
ATTGATGTCGTGTATAGTCG (AGG) |
|
AGTATGGGTGTTCTCTTTGG (AGG) |
. The region of DNA containing the target site was amplified by PCR. The PCR products were hybridized to form heteroduplex DNA, and digested by T7 endonuclease I. The DNA was analyzed by gel electrophoresis . Cas9-IL2RG and Cas9-RAG2 vectors were transfected both or respectively into porcine fibroblast using lipofectamine. Also, to select transfected cells, GFP positive cells were isolated and each of the cells was cultured individually. To verify genetic information, IL2RG and RAG2 genes from the cells were amplified and analyzed the sequences. To confirm the knockout of the genes, we analyzed the DNA sequences. As a result, we established 3 cell lines in IL2RG: 5d, 1a, 190a, and 3 cell lines in RAG2: 2d, 19d, and 1a. Also, for double knockout, we co-transfected the two vectors into the PEF cells, and sorted cells were analyzed. 1d cell line was isolated . As a result, we successfully established cell lines to produce SCID pigs and are trying to produce IL2RG and/or RAG2 knock out pigs.
CITATION INFORMATION: Kim D.-H, Ahn J.-S, Hwang S, Lee J.-W. Establishment of SCID Pigs Cell Lines to Prevent Immunodeficiency Using RGEN System. Am J Transplant. 2016;16 (suppl 3).
To cite this abstract in AMA style:
Kim D-H, Ahn J-S, Hwang S, Lee J-W. Establishment of SCID Pigs Cell Lines to Prevent Immunodeficiency Using RGEN System. [abstract]. Am J Transplant. 2016; 16 (suppl 3). https://atcmeetingabstracts.com/abstract/establishment-of-scid-pigs-cell-lines-to-prevent-immunodeficiency-using-rgen-system/. Accessed November 21, 2024.« Back to 2016 American Transplant Congress